algorithms imaris bitplane n a flowjo v10 becton dickinson bioscience n a prism graphpad n a wave agilent n a matlab mathworks n a other optimem gibco (Oxford Instruments)
Oxford Instruments is a verified supplier 
Oxford Instruments manufactures this product 
99
Structured Review
Oxford Instruments
algorithms imaris bitplane n a flowjo v10 becton dickinson bioscience n a prism graphpad n a wave agilent n a matlab mathworks n a other optimem gibco
Algorithms Imaris Bitplane N A Flowjo V10 Becton Dickinson Bioscience N A Prism Graphpad N A Wave Agilent N A Matlab Mathworks N A Other Optimem Gibco, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 44474 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/algorithms+matlab+mathworks/Imaris/pm39096902-925-69-70
Average 99 stars, based on 44474 article reviews
Algorithms Imaris Bitplane N A Flowjo V10 Becton Dickinson Bioscience N A Prism Graphpad N A Wave Agilent N A Matlab Mathworks N A Other Optimem Gibco, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 44474 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/algorithms+matlab+mathworks/Imaris/pm39096902-925-69-70
Average 99 stars, based on 44474 article reviews
algorithms imaris bitplane n a flowjo v10 becton dickinson bioscience n a prism graphpad n a wave agilent n a matlab mathworks n a other optimem gibco - by Bioz Stars,
2026-11
99/100 stars
Images
Related Articles
Virus:Article Title: A brain atlas of synapse protein lifetime across the mouse lifespan. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-HaloTag Promega Cat# 9211 RRID: AB_2688011 Mouse anti-PSD95 (clone 16/PSD-95) BD Biosciences Cat# 610496 RRID: AB_397862 Bacterial and virus strains AAV9.CamKII.Cre.SV40 Addgene Cat# 105558 AAV2.Ef1a.DIO.eYFP UNC GTC vector Cat# 42585 Chemicals, peptides, and recombinant proteins 4’,6 diamidino-2-phenylindole (DAPI) Sigma-Aldrich Cat# D9542 Alexa Fluor 488 dye solution Life Technologies Cat# A10436 Pluronic F-127 (20% in DMSO) Thermo Fisher Cat# P3000MP ProLong Gold Antifade mounting medium Life Technologies Cat# P36930 OCT embedding matrix CellPath Cat# KMA-0100-00A TMR-Halo Promega Cat# G8251 SiR-COOH Spirochrome Cat# SC004 Amine (O2) HaloTag Promega Cat# P6711 Deposited data Allen mouse brain reference atlas Allen Brain Institute https://mouse.brain-map.org/static/atlas Synaptome data, including data for time points, individual animals and half-life values This paper https://doi.org/10.7488/ds/3070 Experimental models: Cell lines Embryonic stem cell line used for gene targeting: E14Tg2a 08021401 Experimental models: Organisms/strains Mouse: PSD95HaloTag/HaloTag This paper N/A Mouse: PSD95eGFP/eGFP Zhu et al., 2018 N/A Mouse: SAP102mKO2/mKO2 Zhu et al., 2018 N/A Mouse: Dlg2-/- McGee et al., 2001 N/A Oligonucleotides Mouse genotyping primers PSD95-HaloTag: exon F, GTCACATGTCTTTGTGACCTTG This paper N/A Mouse genotyping primers PSD95-HaloTag: 95UTR F, GATACATGCAGAGAGGAGTGTC This paper N/A Mouse genotyping primers PSD95-HaloTag: Halogen F, CTGACTGAAGTCGAGATGGAC This paper N/A Recombinant DNA HaloTag coding sequence Promega https://www.promega.co.uk/resources/ technologies/halotag/ Software and Recombinant:Article Title: A brain atlas of synapse protein lifetime across the mouse lifespan. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-HaloTag Promega Cat# 9211 RRID: AB_2688011 Mouse anti-PSD95 (clone 16/PSD-95) BD Biosciences Cat# 610496 RRID: AB_397862 Bacterial and virus strains AAV9.CamKII.Cre.SV40 Addgene Cat# 105558 AAV2.Ef1a.DIO.eYFP UNC GTC vector Cat# 42585 Chemicals, peptides, and recombinant proteins 4’,6 diamidino-2-phenylindole (DAPI) Sigma-Aldrich Cat# D9542 Alexa Fluor 488 dye solution Life Technologies Cat# A10436 Pluronic F-127 (20% in DMSO) Thermo Fisher Cat# P3000MP ProLong Gold Antifade mounting medium Life Technologies Cat# P36930 OCT embedding matrix CellPath Cat# KMA-0100-00A TMR-Halo Promega Cat# G8251 SiR-COOH Spirochrome Cat# SC004 Amine (O2) HaloTag Promega Cat# P6711 Deposited data Allen mouse brain reference atlas Allen Brain Institute https://mouse.brain-map.org/static/atlas Synaptome data, including data for time points, individual animals and half-life values This paper https://doi.org/10.7488/ds/3070 Experimental models: Cell lines Embryonic stem cell line used for gene targeting: E14Tg2a 08021401 Experimental models: Organisms/strains Mouse: PSD95HaloTag/HaloTag This paper N/A Mouse: PSD95eGFP/eGFP Zhu et al., 2018 N/A Mouse: SAP102mKO2/mKO2 Zhu et al., 2018 N/A Mouse: Dlg2-/- McGee et al., 2001 N/A Oligonucleotides Mouse genotyping primers PSD95-HaloTag: exon F, GTCACATGTCTTTGTGACCTTG This paper N/A Mouse genotyping primers PSD95-HaloTag: 95UTR F, GATACATGCAGAGAGGAGTGTC This paper N/A Mouse genotyping primers PSD95-HaloTag: Halogen F, CTGACTGAAGTCGAGATGGAC This paper N/A Recombinant DNA HaloTag coding sequence Promega https://www.promega.co.uk/resources/ technologies/halotag/ Software and Sequencing:Article Title: A brain atlas of synapse protein lifetime across the mouse lifespan. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-HaloTag Promega Cat# 9211 RRID: AB_2688011 Mouse anti-PSD95 (clone 16/PSD-95) BD Biosciences Cat# 610496 RRID: AB_397862 Bacterial and virus strains AAV9.CamKII.Cre.SV40 Addgene Cat# 105558 AAV2.Ef1a.DIO.eYFP UNC GTC vector Cat# 42585 Chemicals, peptides, and recombinant proteins 4’,6 diamidino-2-phenylindole (DAPI) Sigma-Aldrich Cat# D9542 Alexa Fluor 488 dye solution Life Technologies Cat# A10436 Pluronic F-127 (20% in DMSO) Thermo Fisher Cat# P3000MP ProLong Gold Antifade mounting medium Life Technologies Cat# P36930 OCT embedding matrix CellPath Cat# KMA-0100-00A TMR-Halo Promega Cat# G8251 SiR-COOH Spirochrome Cat# SC004 Amine (O2) HaloTag Promega Cat# P6711 Deposited data Allen mouse brain reference atlas Allen Brain Institute https://mouse.brain-map.org/static/atlas Synaptome data, including data for time points, individual animals and half-life values This paper https://doi.org/10.7488/ds/3070 Experimental models: Cell lines Embryonic stem cell line used for gene targeting: E14Tg2a 08021401 Experimental models: Organisms/strains Mouse: PSD95HaloTag/HaloTag This paper N/A Mouse: PSD95eGFP/eGFP Zhu et al., 2018 N/A Mouse: SAP102mKO2/mKO2 Zhu et al., 2018 N/A Mouse: Dlg2-/- McGee et al., 2001 N/A Oligonucleotides Mouse genotyping primers PSD95-HaloTag: exon F, GTCACATGTCTTTGTGACCTTG This paper N/A Mouse genotyping primers PSD95-HaloTag: 95UTR F, GATACATGCAGAGAGGAGTGTC This paper N/A Mouse genotyping primers PSD95-HaloTag: Halogen F, CTGACTGAAGTCGAGATGGAC This paper N/A Recombinant DNA HaloTag coding sequence Promega https://www.promega.co.uk/resources/ technologies/halotag/ Software and Software:Article Title: A brain atlas of synapse protein lifetime across the mouse lifespan. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-HaloTag Promega Cat# 9211 RRID: AB_2688011 Mouse anti-PSD95 (clone 16/PSD-95) BD Biosciences Cat# 610496 RRID: AB_397862 Bacterial and virus strains AAV9.CamKII.Cre.SV40 Addgene Cat# 105558 AAV2.Ef1a.DIO.eYFP UNC GTC vector Cat# 42585 Chemicals, peptides, and recombinant proteins 4’,6 diamidino-2-phenylindole (DAPI) Sigma-Aldrich Cat# D9542 Alexa Fluor 488 dye solution Life Technologies Cat# A10436 Pluronic F-127 (20% in DMSO) Thermo Fisher Cat# P3000MP ProLong Gold Antifade mounting medium Life Technologies Cat# P36930 OCT embedding matrix CellPath Cat# KMA-0100-00A TMR-Halo Promega Cat# G8251 SiR-COOH Spirochrome Cat# SC004 Amine (O2) HaloTag Promega Cat# P6711 Deposited data Allen mouse brain reference atlas Allen Brain Institute https://mouse.brain-map.org/static/atlas Synaptome data, including data for time points, individual animals and half-life values This paper https://doi.org/10.7488/ds/3070 Experimental models: Cell lines Embryonic stem cell line used for gene targeting: E14Tg2a 08021401 Experimental models: Organisms/strains Mouse: PSD95HaloTag/HaloTag This paper N/A Mouse: PSD95eGFP/eGFP Zhu et al., 2018 N/A Mouse: SAP102mKO2/mKO2 Zhu et al., 2018 N/A Mouse: Dlg2-/- McGee et al., 2001 N/A Oligonucleotides Mouse genotyping primers PSD95-HaloTag: exon F, GTCACATGTCTTTGTGACCTTG This paper N/A Mouse genotyping primers PSD95-HaloTag: 95UTR F, GATACATGCAGAGAGGAGTGTC This paper N/A Mouse genotyping primers PSD95-HaloTag: Halogen F, CTGACTGAAGTCGAGATGGAC This paper N/A Recombinant DNA HaloTag coding sequence Promega https://www.promega.co.uk/resources/ technologies/halotag/ Software and Article Title: Complement C3 Is Activated in Human AD Brain and Is Required for Neurodegeneration in Mouse Models of Amyloidosis and Tauopathy Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies C1q (4.8) Abcam ab182451 RRID: AB_2732849 C3 (11H9) Novus Biologicals NB200-540 RRID: AB_10003444 GFAP (ASTRO6) Thermo Scientific MS-1376-P RRID: AB_62808 Iba1 Wako Chemicals 019-19741 RRID: AB_839504 LAMP1 (1D4B) Abcam ab25245 RRID: AB_449893 Synapsin Synaptic Systems 106006 RRID: AB_2622240 CD68 (FA-11) Bio-Rad MCA1957 RRID: AB_322219 Campbell-Switzer Alzheimer Silver stain (NSA) NeuroScience Associates https://www.neuroscienceassociates.com/ technologies/alzheimers-pathology-stain/ Amino-Cupric Silver stain (NSA) NeuroScience Associates https://www.neuroscienceassociates.com/ technologies/disintegrative-degeneration-stain/ NeuN (NSA) Millipore MAB337B RRID: AB_177621 AT8 (NSA) ThermoScientific MN1020B RRID: AB_223648 GFAP (NSA) Dako Z0334 RRID: AB_10013382 Iba1 (NSA) Wako 019-19741 RRID: AB_839504 anti-C3a R&D Systems AF3677 RRID: AB_2066614 biotinylated anti-C3 Cappel Research Reagents 55033 anti-iC3b/C3b (7C12) Kerafast EG1004 biotinylated anti-C3 F(ab) Protos Immunoresearch 265 pTau (AT8) ThermoFisher MN1020 RRID: AB_223647 pan-Tau Synaptic Systems 314003 RRID: AB_993039 C3 Abcam [EPR19394] ab200999 Beta-Actin HRP-conjugate (AC-15) Sigma A3854 RRID: AB_262011 Biological Samples Human CSF cohort 1 Folio Biosciences n/a Human CSF cohort 2 PrecisionMed n/a Frozen human brain tissue Folio Biosciences n/a Chemicals, Peptides, and Recombinant Proteins Paraformaldehyde Electron Microscopy Sciences 15710 ProLong Diamond Antifade Mountant with DAPI Invitrogen P36971 Normal Donkey Serum Abcam ab7475 NSA Mounting Solution pH 6.0 NeuroScience Associates https://www.neuroscienceassociates.com/ instructions/mounting/ Methoxy-X04 Tocris Bioscience 4920 Critical Commercial Assays Simoa Quanterix https://www.quanterix.com/products- technology/simoa-assay-kits Bio-Plex Pro Mouse Cytokine 23-Plex Assay Bio-Rad #m60009rdpd Deposited Data RNaseq PS2APP sorted cells, 7, 13 mo (Friedman et al., 2018) GSE75431 RNaseq TauP301S sorted microglia (Friedman et al., 2018) GSE93180 RNaseq PS2APP sorted cells, 11.5 mo This study GSE129770 RNaseq TauP301S sorted neurons and astrocytes This study GSE129797 (Continued on next page) e1 Cell Reports 28, 2111–2123.e1–e6, August 20, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental Models: Organisms/Strains MOUSE: Thy-1.PrP.hu.APP.hu.PS2.tg.B6 Roche (Richards et al., 2003) MOUSE: Prnp.Tau.P301S.tg.B6N The Jackson Laboratory Stock No: 02481 MOUSE: C3.ko.B6N Washington University, St. Louis, MO (Circolo et al., 1999) Software and Activity Assay:Article Title: Complement C3 Is Activated in Human AD Brain and Is Required for Neurodegeneration in Mouse Models of Amyloidosis and Tauopathy Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies C1q (4.8) Abcam ab182451 RRID: AB_2732849 C3 (11H9) Novus Biologicals NB200-540 RRID: AB_10003444 GFAP (ASTRO6) Thermo Scientific MS-1376-P RRID: AB_62808 Iba1 Wako Chemicals 019-19741 RRID: AB_839504 LAMP1 (1D4B) Abcam ab25245 RRID: AB_449893 Synapsin Synaptic Systems 106006 RRID: AB_2622240 CD68 (FA-11) Bio-Rad MCA1957 RRID: AB_322219 Campbell-Switzer Alzheimer Silver stain (NSA) NeuroScience Associates https://www.neuroscienceassociates.com/ technologies/alzheimers-pathology-stain/ Amino-Cupric Silver stain (NSA) NeuroScience Associates https://www.neuroscienceassociates.com/ technologies/disintegrative-degeneration-stain/ NeuN (NSA) Millipore MAB337B RRID: AB_177621 AT8 (NSA) ThermoScientific MN1020B RRID: AB_223648 GFAP (NSA) Dako Z0334 RRID: AB_10013382 Iba1 (NSA) Wako 019-19741 RRID: AB_839504 anti-C3a R&D Systems AF3677 RRID: AB_2066614 biotinylated anti-C3 Cappel Research Reagents 55033 anti-iC3b/C3b (7C12) Kerafast EG1004 biotinylated anti-C3 F(ab) Protos Immunoresearch 265 pTau (AT8) ThermoFisher MN1020 RRID: AB_223647 pan-Tau Synaptic Systems 314003 RRID: AB_993039 C3 Abcam [EPR19394] ab200999 Beta-Actin HRP-conjugate (AC-15) Sigma A3854 RRID: AB_262011 Biological Samples Human CSF cohort 1 Folio Biosciences n/a Human CSF cohort 2 PrecisionMed n/a Frozen human brain tissue Folio Biosciences n/a Chemicals, Peptides, and Recombinant Proteins Paraformaldehyde Electron Microscopy Sciences 15710 ProLong Diamond Antifade Mountant with DAPI Invitrogen P36971 Normal Donkey Serum Abcam ab7475 NSA Mounting Solution pH 6.0 NeuroScience Associates https://www.neuroscienceassociates.com/ instructions/mounting/ Methoxy-X04 Tocris Bioscience 4920 Critical Commercial Assays Simoa Quanterix https://www.quanterix.com/products- technology/simoa-assay-kits Bio-Plex Pro Mouse Cytokine 23-Plex Assay Bio-Rad #m60009rdpd Deposited Data RNaseq PS2APP sorted cells, 7, 13 mo (Friedman et al., 2018) GSE75431 RNaseq TauP301S sorted microglia (Friedman et al., 2018) GSE93180 RNaseq PS2APP sorted cells, 11.5 mo This study GSE129770 RNaseq TauP301S sorted neurons and astrocytes This study GSE129797 (Continued on next page) e1 Cell Reports 28, 2111–2123.e1–e6, August 20, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental Models: Organisms/Strains MOUSE: Thy-1.PrP.hu.APP.hu.PS2.tg.B6 Roche (Richards et al., 2003) MOUSE: Prnp.Tau.P301S.tg.B6N The Jackson Laboratory Stock No: 02481 MOUSE: C3.ko.B6N Washington University, St. Louis, MO (Circolo et al., 1999) Software and |